CpG-Oligonukleotid 7909
Nukleinsäure | |
---|---|
TCGTCGTTTTGTCGTTTTGTCGTT | |
Allgemeines | |
Freiname | Agatolimod[1] |
Andere Namen |
|
Identifikatoren | |
GenBank | |
CAS-Nummer | 207623-20-9 |
PubChem | |
Wirkstoffdaten | |
DrugBank | |
Eigenschaften | |
Größe | 24 Nukleotide, 7698,21 Da |
Taxon | synthetisch |
CpG-Oligonukleotid 7909 (auch CpG 7909, Agatolimod) ist ein CpG-Oligonukleotid, das an den TLR9 bindet und daher in der Immunologie und Pharmakologie als Adjuvans verwendet wird.
Eigenschaften
CpG 7909 wird synthetisch per Phosphoramidit-Methode hergestellt. Es hat die Sequenz: 5′-TCGTCGTTTTGTCGTTTTGTCGTT-3′. Das Phosphodiester-Desoxyribose-Rückgrat ist hierbei zu einem Phosphorthioat modifiziert. Dabei wird ein nicht an der Phosphatbrücke beteiligtes Sauerstoffatom durch ein Schwefelatom ersetzt.[3] Dadurch wird es resistent gegenüber DNasen.
Anwendungen
CpG 7909 wird in einer Variante des Anthraximpfstoffs BioThrax verwendet.[4]
Literatur
- A. M. Krieg, A. K. Yi, S. Matson, T. J. Waldschmidt, G. A. Bishop, R. Teasdale, G. A. Koretzky, D. M. Klinman: CpG motifs in bacterial DNA trigger direct B-cell activation. In: Nature. Band 374, Nummer 6522, April 1995, S. 546–549, doi:10.1038/374546a0, PMID 7700380.
- CpG 7909: PF 3512676, PF-3512676. In: Drugs in R&D. Band 7, Nummer 5, 2006, S. 312–316, doi:10.2165/00126839-200607050-00004, PMID 16922592.
Weblinks
Einzelnachweise
- ↑ INN Recommended List 60, World Health Organisation (WHO), 9. September 2008.
- ↑ PubChem: Agatolimod sodium | C238H291N75Na23O127P23S23 | CID 56841789 - PubChem, abgerufen am 20. August 2023.
- ↑ Jeremy M. Berg, John L. Tymoczko, Gregory J. Gatto jr., Lubert Stryer: Stryer Biochemie. Katalytische Strategien. 8. Auflage. Springer, 2018, ISBN 978-3-662-54619-2, S. 321, doi:10.1007/978-3-662-54620-8_9.
- ↑ Jingxing Yang, Jen-Chih Tseng, Guann-Yi Yu, Yunping Luo, Chi-Ying F. Huang, Yi-Ren Hong, Tsung-Hsien Chuang: Recent Advances in the Development of Toll-like Receptor Agonist-Based Vaccine Adjuvants for Infectious Diseases. In: Pharmaceutics. 2022, Band 14, Nummer 2, S. 423 doi:10.3390/pharmaceutics14020423. PMID 35214155. PMC 8878135 (freier Volltext).
Auf dieser Seite verwendete Medien
author: JohnDoe001
source: Created using Microsoft Powerpoint and Publisher
I created this diagram